JAVA Program Need Screenshots of Working Code Pls

JAVA Program Need Screenshots of Working Code Pls::

1) Attached is a file called genomic_dna.txt. It contains a DNA sequence that is comprised of two

exons and an intron. The first exon runs from the start of the sequence to the 63 bp, and the

second exon runs from the 91 bp to the end of the sequence. Rite a JAVA program that will print out

to files the coding and non-coding regions of the sequence (i.e. The exons in one file called

coding.txt, and the intron into another file called non_coding.txt).

2) Modify your code for Q1 above so it calculates what percentage of the sequence is coding and

displays the result to the screen.

******See contents of genomic_dna.txt below******

ATCGATCGATCGATCGACTGACTAGTCATAGCTATGCATGTAGCTACTCGATCGATCGATCGATCGATCGATCGATCGATCGATCATGCTATCATCGATCGATATCGATGCATCGACTACTAT